From posttopublicity at ijop.org Tue Apr 3 05:55:40 2007 From: posttopublicity at ijop.org (E. Segura) Date: Tue, 3 Apr 2007 02:55:40 -0700 Subject: [MOBY-l] CFP - 2nd IEEE International Workshop Towards Stable and Adaptable Software Architectures (SASA 2007) Message-ID: <7ba949be8c55c881768339e3c50b1c0b@ijop.org> The 2nd IEEE International Workshop Towards Stable and Adaptable Software Architectures SASA 2007 Invitation Las Vegas, USA, August 13-15, 2007 (in conjunction with IEEE IRI 2007) http://www.sis.pitt.edu/~iri07/ (IEEE IRI 2007 Link) http://www.sis.pitt.edu/~iri07/wkshpCFP2.html (Workshop Link 1) http://www.engr.sjsu.edu/~fayad/workshops/SASA07 (Workshop Link 2) http://www.vrlsoft.com/workshops/SASA07 (Workshop Link 3) Greetings, I would like to invite you to participate in The 2nd IEEE International Workshop Towards Stable and Adaptable Software Architectures (SASA 2007)" In conjunction with The 2007 IEEE International Conference on Information Reuse and Integration (http://www.sis.pitt.edu/~iri07/), which will take place in Las Vegas, Nevada, August 13-15, 2OO7 by submitting a paper or two before or on April 15, 2007. A call of papers for the workshop is enclosed and it can be found at: http://www.sis.pitt.edu/~iri07/wkshpCFP2.html (Workshop Link 1) http://www.engr.sjsu.edu/~fayad/workshops/SASA07 (Workshop Link 2) http://www.vrlsoft.com/workshops/SASA07 (Workshop Link 3) Accepted papers will be published in the proceedings (EI Index) of the The 2007 IEEE International Conference on Information Reuse and Integration (IEEE IRI 2007). The workshop selected best papers will be published in online Journal of International Journal Of Patterns (IJOP). Looking forward to your submission and participation in the workshop! All the best, Cheers, Dr. M.E. Fayad (Chair) Dr. Rami Bahsoon (Co-Chair) Dr. Tarek Helmy (Co-Chair) Eduardo M. Segura (Co-Chair) -- ijop.org -- Powered by PHPlist, www.phplist.com -- From posttopublicity at ijop.org Tue Apr 3 06:53:00 2007 From: posttopublicity at ijop.org (E.Segura) Date: Tue, 3 Apr 2007 03:53:00 -0700 Subject: [MOBY-l] 2nd IEEE International Workshop on Software Stability at Work (SSW 2007) Message-ID: <6eb2f9035a699de92c14351fdc5708fb@ijop.org> The 2nd IEEE International Workshop on Software Stability at Work SSW 2007 Invitation Las Vegas, USA, August 13-15, 2007 (in conjunction with IEEE IRI 2007) http://www.sis.pitt.edu/~iri07/ (IEEE IRI 2007 Link) http://www.sis.pitt.edu/~iri07/wkshpCFP3.html (Main Link) http://www.engr.sjsu.edu/~fayad/workshops/IRI07-SSW (Workshop Link 2) http://www.vrlsoft.com/workshops/SSW07 (Workshop Link 3) Greetings, I would like to invite you to participate in The 2nd IEEE International Workshop on Software Stability at Work. (SSW 2007)" In conjunction with The 2007 IEEE International Conference on Information Reuse and Integration (http://www.sis.pitt.edu/~iri07/), which will take place in Las Vegas, Nevada, August 13-15, 2OO7 by submitting a paper or two before or on April 15, 2007. A call of papers for the workshop is enclosed and it can be found at: http://www.sis.pitt.edu/~iri07/wkshpCFP3.html (Main Link) http://www.engr.sjsu.edu/~fayad/workshops/IRI07-SSW (Workshop Link 2) http://www.vrlsoft.com/workshops/SSW07 (Workshop Link 3) Accepted papers will be published in the proceedings (EI Index) of the The 2007 IEEE International Conference on Information Reuse and Integration (IEEE IRI 2007). The workshop selected best papers will be published in online Journal of International Journal Of Patterns (IJOP). Looking forward to your submission and participation in the workshop! All the best, Cheers, Dr. M.E. Fayad (Chair) Dr. Rami Bahsoon (Co-Chair) Dr. Chia-Chu Chiang (Co-Chair) Dr. Shasha Wu (Co-Chair) -- ijop.org -- Powered by PHPlist, www.phplist.com -- From markw at illuminae.com Wed Apr 11 16:11:56 2007 From: markw at illuminae.com (Mark Wilkinson) Date: Wed, 11 Apr 2007 13:11:56 -0700 Subject: [MOBY-l] Fwd: Postdoc position for WebService development for semantic data and tool integration In-Reply-To: <461CFA4C.4050508@ipk-gatersleben.de> References: <461CFA4C.4050508@ipk-gatersleben.de> Message-ID: ------- Forwarded message ------- From: "M. Lange" To: gofriends at genome.stanford.edu Cc: Subject: Postdoc position for WebService development for semantic data and tool integration Date: Wed, 11 Apr 2007 08:10:04 -0700 Job description: The Leibniz Institute of Plant Genetics and Crop Plant Research (http://www.ipk-gatersleben.de) is a leading institute in crop plant research. This results in several international published databases and developed software tools. This data and software build an important bioinformatics resource for the scientific community. The positive impact for the IPK bioinformatics research can increase by supporting WebService repositories like BioMoby or BioCase. The final goal is embedding the institute into international bioinformatics resource networks. Examples for such networks are the "Virtual Plant Information Network" (VPIN), the PlaNet-Network or the international initiative "Global Biodiversity Information Facility" (GBIF). Thus, this scholarship focuses on the concrete implementation of such a service and should support the service work of the IPK bioinformatics groups. This service must be implemented using standardized computer science and bioinformatics methods, like XML, Web Services, ontologies, semantic Web and database integration. Specific Requirements of the candidate: The project's goals require a Bioinformatics Postdoc with special experience in - database concepts and technologies, - SQL - Web-service techniques - biological databases, - XML processing, - JAVA and Perl programming languages - UNIX operating systems Contract: A contract of 1 year will be offered to the successful candidate. Matthias Lange Group Leader IT Leibniz Institute of Plant Genetics and Crop Plant Research Tel: +49 39482 5693 Fax: +49 39482 5139 E-mail: lange at ipk-gatersleben.de URL: http://www.ipk-gatersleben.de -- -- Mark Wilkinson Assistant Professor, Dept. Medical Genetics University of British Columbia PI Bioinformatics iCAPTURE Centre, St. Paul's Hospital Tel: 604 682 2344 x62129 Fax: 604 806 9274 ***CONFIDENTIALITY NOTICE*** This electronic message is intended only for the use of the addressee and may contain information that is privileged and confidential. Any dissemination, distribution or copying of this communication by unauthorized individuals is strictly prohibited. If you have received this communication in error, please notify the sender immediately by reply e-mail and delete the original and all copies from your system. From posttopublicity at ijop.org Wed Apr 11 20:46:39 2007 From: posttopublicity at ijop.org (SPBlog) Date: Wed, 11 Apr 2007 17:46:39 -0700 Subject: [MOBY-l] Software Patterns Blog Message-ID: <0c706aeef4554dbca247169d3219eb5a@ijop.org> Greetings, I am pleased to broadcast the launch of a new blog called the software pattern blog http://pattern.ijop.org . This blog belongs to the editors of IJOP, columnists, staff, advisory, editorial and domain expert boards, external reviewers, and to those who have been specially invited. It is an open forum which is managed by Dr. M. E. Fayad and his associates, if you would like to submit an article to the Software Pattern Blog, please email it to patterns-blog at ijop.org and refer to the guidelines at http://pattern.ijop.org/?page_id=4 This blog focuses on software patterns, stable analysis and design patterns, architectural patterns, pattern languages and how to develop systems of patterns. In order to keep the spam at a minimum, postings will be moderated. Also please avoid anonymous/spoofed posting. The objective of this blog is to foster mature discussions about issues that affect all software developers and practitioners nowadays. Feel more than welcome to participate! To start reading and subscribing to the blog, click here . Sincerely, Eduardo M. Segura Co-Founder and Project Manager vrlSoft, Inc. -- ijop.org -- Powered by PHPlist, www.phplist.com -- From kieran at nbn.ac.za Mon Apr 16 18:02:08 2007 From: kieran at nbn.ac.za (Kieran O'Neill) Date: Tue, 17 Apr 2007 00:02:08 +0200 Subject: [MOBY-l] Differences between BioMoby and DAS Message-ID: <4623F260.4010201@nbn.ac.za> -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Hi there I was wondering if anyone on this list knows of a paper comparing BioMoby and DAS, highlighting the similarities and differences between the two systems. The two are obviously somewhat similar, being systems with a central registry describing distributed web services, but I think they may have slightly different applications. Also, if I'm not mistaken, BioMoby uses an ontology to describe its services, whereas an ontology has yet to be finalised for DAS. Thank-you in advance Kieran - -- "So, did you bring any of these `protons' with you?" - -US border guard to my aunt, the radiographer, on her way to a conference on proton radiotherapy. -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.4.6 (GNU/Linux) iD8DBQFGI/Jf0TLED9JKVp0RArHQAJ9cpzcgCaDd0gE/pre+xK56C4XN3QCdHZ40 GLAXhon6Pk2Am5Q4JXZ+8Bs= =f5Om -----END PGP SIGNATURE----- From clushbou at usd.edu Thu Apr 19 11:50:47 2007 From: clushbou at usd.edu (Carol Lushbough) Date: Thu, 19 Apr 2007 10:50:47 -0500 Subject: [MOBY-l] Sample Code Message-ID: <46278FD7.5060902@usd.edu> I was wondering if anyone had an example of Java Client code that executes a tool where the primary parameter is a collection of something such as GCP_FeatureWithValue (service GetMGISAccessionList). Thanks! -- Carol Lushbough Assistant Professor of Computer Science University of South Dakota Vermillion, SD 57069 (605) 677-6138 From posttopublicity at ijop.org Thu Apr 19 16:56:34 2007 From: posttopublicity at ijop.org (E. Segura) Date: Thu, 19 Apr 2007 13:56:34 -0700 Subject: [MOBY-l] Extended deadline: CFP - SASA 2007 Message-ID: <1e0233d70f0a811015d209dec58e64b3@ijop.org> Please note: The paper submission deadline has been extended to April 30, 2007 The 2nd IEEE International Workshop Towards Stable and Adaptable Software Architectures SASA 2007 Invitation Las Vegas, USA, August 13-15, 2007 (in conjunction with IEEE IRI 2007) http://www.sis.pitt.edu/~iri07/ (IEEE IRI 2007 Link) http://www.sis.pitt.edu/~iri07/wkshpCFP2.html (Workshop Link 1) http://www.engr.sjsu.edu/~fayad/workshops/SASA07 (Workshop Link 2) http://www.vrlsoft.com/workshops/SASA07 (Workshop Link 3) Greetings, I would like to invite you to participate in The 2nd IEEE International Workshop Towards Stable and Adaptable Software Architectures (SASA 2007)" In conjunction with The 2007 IEEE International Conference on Information Reuse and Integration (http://www.sis.pitt.edu/~iri07/), which will take place in Las Vegas, Nevada, August 13-15, 2OO7 by submitting a paper or two before or on April 30, 2007. A call of papers for the workshop is enclosed and it can be found at: http://www.sis.pitt.edu/~iri07/wkshpCFP2.html (Workshop Link 1) http://www.engr.sjsu.edu/~fayad/workshops/SASA07 (Workshop Link 2) http://www.vrlsoft.com/workshops/SASA07 (Workshop Link 3) Accepted papers will be published in the proceedings (EI Index) of the The 2007 IEEE International Conference on Information Reuse and Integration (IEEE IRI 2007). The workshop selected best papers will be published in online Journal of International Journal Of Patterns (IJOP). Looking forward to your submission and participation in the workshop! All the best, Cheers, Dr. M.E. Fayad (Chair) Dr. Rami Bahsoon (Co-Chair) Dr. Tarek Helmy (Co-Chair) Eduardo M. Segura (Co-Chair) -- ijop.org -- Powered by PHPlist, www.phplist.com -- From posttopublicity at ijop.org Thu Apr 19 16:58:35 2007 From: posttopublicity at ijop.org (E. Segura) Date: Thu, 19 Apr 2007 13:58:35 -0700 Subject: [MOBY-l] Extended deadline: CFP - SSW 2007 Message-ID: Please note: The paper submission deadline has been extended to April 30, 2007 The 2nd IEEE International Workshop on Software Stability at Work SSW 2007 Invitation Las Vegas, USA, August 13-15, 2007 (in conjunction with IEEE IRI 2007) http://www.sis.pitt.edu/~iri07/ (IEEE IRI 2007 Link) http://www.sis.pitt.edu/~iri07/wkshpCFP3.html (Main Link) http://www.engr.sjsu.edu/~fayad/workshops/IRI07-SSW (Workshop Link 2) www.vrlsoft.com/workshops/SSW07 (Workshop Link 3) Greetings, I would like to invite you to participate in The First IEEE International Workshop on Software Stability at Work. (SSW 2007)" In conjunction with The 2007 IEEE International Conference on Information Reuse and Integration (http://www.sis.pitt.edu/~iri07/), which will take place in Las Vegas, Nevada, August 13-15, 2OO7 by submitting a paper or two before or on April 30, 2007. A call of papers for the workshop is enclosed and it can be found at: http://www.sis.pitt.edu/~iri07/wkshpCFP3.html (Main Link) http://www.engr.sjsu.edu/~fayad/workshops/IRI07-SSW (Workshop Link 2) www.vrlsoft.com/workshops/SSW07 (Workshop Link 3) Accepted papers will be published in the proceedings (EI Index) of the The 2007 IEEE International Conference on Information Reuse and Integration (IEEE IRI 2007). The workshop selected best papers will be published in online Journal of International Journal Of Patterns (IJOP). Looking forward to your submission and participation in the workshop! All the best, Cheers, Dr. M.E. Fayad (Chair) Dr. Rami Bahsoon (Co-Chair) Dr. Chia-Chu Chiang (Co-Chair) Dr. Shasha Wu (Co-Chair) -- ijop.org -- Powered by PHPlist, www.phplist.com -- From markw at illuminae.com Fri Apr 20 11:06:34 2007 From: markw at illuminae.com (Mark Wilkinson) Date: Fri, 20 Apr 2007 08:06:34 -0700 Subject: [MOBY-l] Differences between BioMoby and DAS In-Reply-To: <4623F260.4010201@nbn.ac.za> References: <4623F260.4010201@nbn.ac.za> Message-ID: Hi Kieran, I don't think there is a paper out there that discusses this, and that may be because the two are not really so similar :-) I think of DAS as more of a query language - you can construct fairly arbitrary queries over sequence databases to retrieve features. Moby is anything but a query language (in fact, I have struggled numerous times trying to shoe-horn arbitrary queries into Moby, but was never able to come up with a sensible solution to this). The request and response in Moby are ~identical; Moby is a data-transformation system, not a query system. You might have more commonality if you compared DAS with e.g. BioCASE, since the intentions seem to be more similar between those two projects...?? Just my initial thoughts :-) M On Mon, 16 Apr 2007 15:02:08 -0700, Kieran O'Neill wrote: > -----BEGIN PGP SIGNED MESSAGE----- > Hash: SHA1 > > Hi there > > I was wondering if anyone on this list knows of a paper comparing > BioMoby and DAS, highlighting the similarities and differences between > the two systems. The two are obviously somewhat similar, being systems > with a central registry describing distributed web services, but I > think they may have slightly different applications. Also, if I'm not > mistaken, BioMoby uses an ontology to describe its services, whereas > an ontology has yet to be finalised for DAS. > > Thank-you in advance > Kieran > > - -- > "So, did you bring any of these `protons' with you?" > - -US border guard to my aunt, the radiographer, on her way to a > conference on proton radiotherapy. > -----BEGIN PGP SIGNATURE----- > Version: GnuPG v1.4.6 (GNU/Linux) > > iD8DBQFGI/Jf0TLED9JKVp0RArHQAJ9cpzcgCaDd0gE/pre+xK56C4XN3QCdHZ40 > GLAXhon6Pk2Am5Q4JXZ+8Bs= > =f5Om > -----END PGP SIGNATURE----- > > _______________________________________________ > moby-l mailing list > moby-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/moby-l -- -- Mark Wilkinson Assistant Professor, Dept. Medical Genetics University of British Columbia PI Bioinformatics iCAPTURE Centre, St. Paul's Hospital Tel: 604 682 2344 x62129 Fax: 604 806 9274 ***CONFIDENTIALITY NOTICE*** This electronic message is intended only for the use of the addressee and may contain information that is privileged and confidential. Any dissemination, distribution or copying of this communication by unauthorized individuals is strictly prohibited. If you have received this communication in error, please notify the sender immediately by reply e-mail and delete the original and all copies from your system. From gordonp at ucalgary.ca Fri Apr 20 11:30:36 2007 From: gordonp at ucalgary.ca (Paul Gordon) Date: Fri, 20 Apr 2007 09:30:36 -0600 Subject: [MOBY-l] Differences between BioMoby and DAS In-Reply-To: References: <4623F260.4010201@nbn.ac.za> Message-ID: <4628DC9C.7070108@ucalgary.ca> I think you hit the mail of the head there Mark. DAS is more like SQL, and Moby is more like RPC (in a very abstract sense). > Hi Kieran, > > I don't think there is a paper out there that discusses this, and that may > be because the two are not really so similar :-) > > I think of DAS as more of a query language - you can construct fairly > arbitrary queries over sequence databases to retrieve features. Moby is > anything but a query language (in fact, I have struggled numerous times > trying to shoe-horn arbitrary queries into Moby, but was never able to > come up with a sensible solution to this). The request and response in > Moby are ~identical; Moby is a data-transformation system, not a query > system. > > You might have more commonality if you compared DAS with e.g. BioCASE, > since the intentions seem to be more similar between those two > projects...?? > > Just my initial thoughts :-) > > M > > > > > On Mon, 16 Apr 2007 15:02:08 -0700, Kieran O'Neill > wrote: > > >> -----BEGIN PGP SIGNED MESSAGE----- >> Hash: SHA1 >> >> Hi there >> >> I was wondering if anyone on this list knows of a paper comparing >> BioMoby and DAS, highlighting the similarities and differences between >> the two systems. The two are obviously somewhat similar, being systems >> with a central registry describing distributed web services, but I >> think they may have slightly different applications. Also, if I'm not >> mistaken, BioMoby uses an ontology to describe its services, whereas >> an ontology has yet to be finalised for DAS. >> >> Thank-you in advance >> Kieran >> >> - -- >> "So, did you bring any of these `protons' with you?" >> - -US border guard to my aunt, the radiographer, on her way to a >> conference on proton radiotherapy. >> -----BEGIN PGP SIGNATURE----- >> Version: GnuPG v1.4.6 (GNU/Linux) >> >> iD8DBQFGI/Jf0TLED9JKVp0RArHQAJ9cpzcgCaDd0gE/pre+xK56C4XN3QCdHZ40 >> GLAXhon6Pk2Am5Q4JXZ+8Bs= >> =f5Om >> -----END PGP SIGNATURE----- >> >> _______________________________________________ >> moby-l mailing list >> moby-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/moby-l >> > > > > From clushbou at usd.edu Thu Apr 26 16:53:59 2007 From: clushbou at usd.edu (Carol Lushbough) Date: Thu, 26 Apr 2007 15:53:59 -0500 Subject: [MOBY-l] Problem with runGeneIDGFF code Message-ID: <46311167.5050208@usd.edu> I was wondering if someone could help me figure out a problem I'm having with [genome.imim.es] runGeneIDGFF Web service. I'm able to successfully execute it at http://www.inab.org/MOWServ/ but cannot successfully execute it through Dashboard or my Java program. Through my Java program, I get the following error. I've also included my code. Any help would be greatly appreciated. I'm sure I'm doing something dumb. I think I'm using the default endpoint. ARNING: Unable to find required classes (javax.activation.DataHandler and javax.mail.internet.MimeMultipart). Attachment support is disabled. Exception in thread "main" java.lang.IllegalArgumentException: Simple element has no MOBY child element, there is no instance to create at org.biomoby.shared.data.MobyDataObject.createInstanceFromDOM(MobyDataObject.java:118) at org.biomoby.shared.data.MobyContentInstance.parseDataGroup(MobyContentInstance.java:209) at org.biomoby.shared.data.MobyContentInstance.(MobyContentInstance.java:115) at org.biomoby.shared.data.MobyDataUtils.fromXMLDocument(MobyDataUtils.java:84) at org.biomoby.client.MobyRequest.invokeService(MobyRequest.java:271) at testpackage.HelloMOBY.main(HelloMOBY.java:108)* * ============================================================================= Central worker = new CentralImpl(); MobyService templateService = new MobyService("runGeneIDGFF"); MobyRequest mr = new MobyRequest(worker); MobyService[] validServices = worker.findService(templateService); mr.setService(validServices[0]); // String sequence = getTestSequence(); String sequence = ""; sequence += "ctgagctgggcaggtgtcctgcaatcctggtgaatattcagcggtctgtgtccccttggctagctc"; sequence += "tgcctatgcaaacagccacctgagaaggggaagcagagggtgcggtggaaacggctgtgtcaggggacagc"; sequence += "aggggaaggaagatagccaaggcttactgaggctggtggagggagccactccatttccttg"; MobyDataType dataType = new MobyDataType("DNASequence"); MobyDataComposite dnaSequenceObject = new MobyDataComposite(dataType,"sequence"); dnaSequenceObject.put("SequenceString", new MobyDataString(sequence)); dnaSequenceObject.put("Length", new MobyDataInt(sequence.length())); mr.setInput(dnaSequenceObject); MobyDataSecondaryInstance[] secondaryData = new MobyDataSecondaryInstance[5]; MobySecondaryData p1 = new MobySecondaryData("strand"); p1.setDataType("String"); p1.setDefaultValue("Both"); MobySecondaryData p2 = new MobySecondaryData("profile"); p2.setDataType("String"); p2.setDefaultValue("Homo sapiens (suitable for mammals)"); MobySecondaryData p3 = new MobySecondaryData("engine"); p3.setDataType("String"); p3.setDefaultValue("Normal"); MobySecondaryData p4 = new MobySecondaryData("signals"); p4.setDataType("String"); p4.setDefaultValue("None"); MobySecondaryData p5 = new MobySecondaryData("exons"); p5.setDataType("String"); p5.setDefaultValue("None"); secondaryData[0] = new MobyDataSecondaryInstance(p1); secondaryData[1] = new MobyDataSecondaryInstance(p2); secondaryData[2] = new MobyDataSecondaryInstance(p3); secondaryData[3] = new MobyDataSecondaryInstance(p4); secondaryData[4] = new MobyDataSecondaryInstance(p5); mr.setSecondaryInput(secondaryData); MobyContentInstance mobyContent = mr.invokeService(); String response = mobyContent.toXML(); -- Carol Lushbough Assistant Professor of Computer Science University of South Dakota Vermillion, SD 57069 (605) 677-6138 From martin.senger at gmail.com Thu Apr 26 19:16:16 2007 From: martin.senger at gmail.com (Martin Senger) Date: Fri, 27 Apr 2007 00:16:16 +0100 Subject: [MOBY-l] Problem with runGeneIDGFF code In-Reply-To: <46311167.5050208@usd.edu> References: <46311167.5050208@usd.edu> Message-ID: <4d93f07c0704261616j2a42ec51pe93a159fed2557f8@mail.gmail.com> Hi, but cannot successfully execute it through Dashboard I think I can help you with it if you tell me what error message are you getting in Dashboard. Through my Java program, I get the following error. I've also included my > code. The code seems to be using MobyRequest - this is a different approach than I am using in Dashboard and in the BaseClient. You have to wait for Paul Gordon to answer it. If you wish to know more about differences between these two approaches please look them up in the jMoby documentation ( http://biomoby.open-bio.org/CVS_CONTENT/moby-live/Java/docs/). Martin -- Martin Senger email: martin.senger at gmail.com skype: martinsenger